93
|
ATCC
c difficile atcc 9689d C Difficile Atcc 9689d, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c difficile atcc 9689d/product/ATCC Average 93 stars, based on 1 article reviews
c difficile atcc 9689d - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
90
|
ATCC
wild type c cohnii strain atcc mk8805 Wild Type C Cohnii Strain Atcc Mk8805, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/wild type c cohnii strain atcc mk8805/product/ATCC Average 90 stars, based on 1 article reviews
wild type c cohnii strain atcc mk8805 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
91
|
ATCC
c curvus atcc 35224 C Curvus Atcc 35224, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c curvus atcc 35224/product/ATCC Average 91 stars, based on 1 article reviews
c curvus atcc 35224 - by Bioz Stars,
2026-05
91/100 stars
|
Buy from Supplier |
96
|
ATCC
caption a7 Caption A7, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7/product/ATCC Average 96 stars, based on 1 article reviews
caption a7 - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |
99
|
ATCC
c circle positive control standard curve dna C Circle Positive Control Standard Curve Dna, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c circle positive control standard curve dna/product/ATCC Average 99 stars, based on 1 article reviews
c circle positive control standard curve dna - by Bioz Stars,
2026-05
99/100 stars
|
Buy from Supplier |
95
|
ATCC
atcca 33237 agacaagaatttgcaaaaggtatccctcaa aatcgcttgaaaagatctttgtcttccttg c curvus seq id Atcca 33237 Agacaagaatttgcaaaaggtatccctcaa Aatcgcttgaaaagatctttgtcttccttg C Curvus Seq Id, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/atcca 33237 agacaagaatttgcaaaaggtatccctcaa aatcgcttgaaaagatctttgtcttccttg c curvus seq id/product/ATCC Average 95 stars, based on 1 article reviews
atcca 33237 agacaagaatttgcaaaaggtatccctcaa aatcgcttgaaaagatctttgtcttccttg c curvus seq id - by Bioz Stars,
2026-05
95/100 stars
|
Buy from Supplier |
92
|
ATCC
c curvus 525 92 C Curvus 525 92, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c curvus 525 92/product/ATCC Average 92 stars, based on 1 article reviews
c curvus 525 92 - by Bioz Stars,
2026-05
92/100 stars
|
Buy from Supplier |
95
|
ATCC
positive control specimen Positive Control Specimen, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/positive control specimen/product/ATCC Average 95 stars, based on 1 article reviews
positive control specimen - by Bioz Stars,
2026-05
95/100 stars
|
Buy from Supplier |
92
|
ATCC
c concisus cp000792 c curvis c curvis cp000767 c fetus C Concisus Cp000792 C Curvis C Curvis Cp000767 C Fetus, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c concisus cp000792 c curvis c curvis cp000767 c fetus/product/ATCC Average 92 stars, based on 1 article reviews
c concisus cp000792 c curvis c curvis cp000767 c fetus - by Bioz Stars,
2026-05
92/100 stars
|
Buy from Supplier |
99
|
ATCC
c albicans C Albicans, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/c albicans/product/ATCC Average 99 stars, based on 1 article reviews
c albicans - by Bioz Stars,
2026-05
99/100 stars
|
Buy from Supplier |
90
|
Ribobio co
siaeg-1 sense Siaeg 1 Sense, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/siaeg-1 sense/product/Ribobio co Average 90 stars, based on 1 article reviews
siaeg-1 sense - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
99
|
ATCC
16s rrna  16s Rrna, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/16s rrna/product/ATCC Average 99 stars, based on 1 article reviews
16s rrna - by Bioz Stars,
2026-05
99/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Frontiers in Microbiology
Article Title: Enhancing Nitrification at Low Temperature with Zeolite in a Mining Operations Retention Pond
doi: 10.3389/fmicb.2012.00271
Figure Lengend Snippet: Relative abundances of bacterial amoA genes and potential nitrification activity in the retention pond water by month .
Article Snippet: C t values were calculated from standard curves of cloned
Techniques: Activity Assay
Journal: Frontiers in Microbiology
Article Title: Enhancing Nitrification at Low Temperature with Zeolite in a Mining Operations Retention Pond
doi: 10.3389/fmicb.2012.00271
Figure Lengend Snippet: PCR primers used in this study .
Article Snippet: C t values were calculated from standard curves of cloned
Techniques: Sequencing, Amplification